View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1430_low_29 (Length: 238)
Name: NF1430_low_29
Description: NF1430
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1430_low_29 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 204; Significance: 1e-111; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 1 - 216
Target Start/End: Original strand, 32177620 - 32177835
Alignment:
| Q |
1 |
aggtggaaggttaaatgggacacggttaacttgagggaaacaagagtgaaagtgatcaaggagttgtgattctgcaagagaaacagtgggaagaggagtg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32177620 |
aggtggaaggttaaatgggacacggttaacttgagggaaacaagagtgaaagtgatcaaggagttgtgattctgcaagagaaacagtgggaagaggagtg |
32177719 |
T |
|
| Q |
101 |
atgagagtgactttgcaattgttgttgagaaacaatgatgctagtcttaggaatggtgtgagatgacccattcctgcacttgggaacatggcaacatgaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
32177720 |
atgagagtgactttgcaattgttgttgagaaacaatgatgctagtcttaggaatggtgtgagatgacccattccagcacttgggaacatggcaacatgaa |
32177819 |
T |
|
| Q |
201 |
cagtttcatcagacat |
216 |
Q |
| |
|
|| |||||||||||| |
|
|
| T |
32177820 |
caacttcatcagacat |
32177835 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 29 - 225
Target Start/End: Original strand, 32184809 - 32185005
Alignment:
| Q |
29 |
acttgagggaaacaagagtgaaagtgatcaaggagttgtgattctgcaagagaaacagtgggaagaggagtgatgagagtgactttgcaattgttgttga |
128 |
Q |
| |
|
|||||||||||| ||||||||||||||||||| || || |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
32184809 |
acttgagggaaagaagagtgaaagtgatcaagaagctgggattctgcaagagagacagtgggaagaggagtgatgagagtgactttgcaattgttgttaa |
32184908 |
T |
|
| Q |
129 |
gaaacaatgatgctagtcttaggaatggtgtgagatgacccattcctgcacttgggaacatggcaacatgaacagtttcatcagacattgcttattg |
225 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||| |||||||||||||||| |||| |
|
|
| T |
32184909 |
gaaacaatgatgctagtcttaggaatggtgtgagatgacccattccagcacttggaaacatggcaacatgaacaacttcatcagacattgctaattg |
32185005 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University