View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14310_high_7 (Length: 360)
Name: NF14310_high_7
Description: NF14310
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14310_high_7 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 175; Significance: 4e-94; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 175; E-Value: 4e-94
Query Start/End: Original strand, 164 - 346
Target Start/End: Complemental strand, 9801163 - 9800981
Alignment:
| Q |
164 |
ttagcaatgaatatacacatattttccattaagctttgtgcaatgtgcactactgccctatatgaaaataaacgaagctttatacaatgcatggttttct |
263 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9801163 |
ttagcaatgtatatacacatattttccattaagctttgtgcaatgtgcactactgccctatatgaaaataaacgaagctttatacaatgcatggttttct |
9801064 |
T |
 |
| Q |
264 |
tccgtatatgtgggtggcagtatgattttcaattgcagtttttcagttatgcacttatgctgcaactgcaaaccttaatattg |
346 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9801063 |
tccgtatatgtgggtggcagtatgattttcaattgcagttttgcagttatgcacttatgctgcaactgcaaaccttaatattg |
9800981 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 151 - 203
Target Start/End: Complemental strand, 9827624 - 9827572
Alignment:
| Q |
151 |
ttaatattttactttagcaatgaatatacacatattttccattaagctttgtg |
203 |
Q |
| |
|
|||||||||||||| |||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
9827624 |
ttaatattttacttcagcaataaatatacacatatttggcattaagctttgtg |
9827572 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University