View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14310_low_11 (Length: 270)
Name: NF14310_low_11
Description: NF14310
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14310_low_11 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 17 - 263
Target Start/End: Original strand, 6587763 - 6588011
Alignment:
| Q |
17 |
cattggtggcaagtttgtgggttcagccaacataatcatgacccttcatctcaatggctcactcaagaaaatgcttagagaagctggtgcactttggctt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6587763 |
cattggtggcaagtttgtgggttcagccaacataatcatgacccttcatctcaatggctcactcaagaaaatgcttagagaagctggtgcactttggctt |
6587862 |
T |
|
| Q |
117 |
taggaaaacttgaaatatggaagctcgcattctagtgcaaatgcaaacagccaaaaattgccttttttatataatatcctaaccaagccctc--nnnnnn |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
6587863 |
taggaaaacttgaaatatggaagctcgcattctagtgcaaatgcaaacagccaaaaatggccttttttatataatatcctaaccaagccctctttttttt |
6587962 |
T |
|
| Q |
215 |
nnngtgagaccttgcggctttaagaatatgcattgtattagaataatct |
263 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6587963 |
tttgtgagaccttgcggctttaagaatatgcattgtattagaataatct |
6588011 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University