View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14311_high_4 (Length: 310)
Name: NF14311_high_4
Description: NF14311
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14311_high_4 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 255; Significance: 1e-142; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 255; E-Value: 1e-142
Query Start/End: Original strand, 22 - 288
Target Start/End: Complemental strand, 528463 - 528197
Alignment:
| Q |
22 |
tccatatgtcctagccaatttggtcagttcatccattccaacaacagcaagctctacaatcttttgcttctcattaagacccttaatctgcactgaggag |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
528463 |
tccatatgtcctagccaatttggtcagttcatccattccaacaacagcaagctctacaatcttttgcttctcattaagacccttaatctgcactgaggag |
528364 |
T |
 |
| Q |
122 |
ccaccaacgcttaaaccctcttctaccatgcggtggcttgctccattgttaccaccggcaactccaaaatcagtagagcgtgaagcaacatgagtgctat |
221 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||| |
|
|
| T |
528363 |
ccaccaacgcttaaaccctctcctaccatgcggtggcttgctccattgttaccaccggcaactccaaaatccgtagagtgtgaagcaacatgagtgctat |
528264 |
T |
 |
| Q |
222 |
tgttggatgatgttatattggcacgagagtctgtcggcgtctcgcccacaaacctttcaagctggcg |
288 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
528263 |
tgttggatgatgttatattggcacgagagtctgtcggcgtctcgcccacaaacctttcaagctggcg |
528197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University