View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14311_low_2 (Length: 541)
Name: NF14311_low_2
Description: NF14311
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14311_low_2 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 115; Significance: 4e-58; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 115; E-Value: 4e-58
Query Start/End: Original strand, 19 - 193
Target Start/End: Original strand, 14178478 - 14178655
Alignment:
| Q |
19 |
aaatggaaagacctacata--aatgcatttatcatctgtaaagagaattttgaggtacttgaaaggaattgtcaattttgaagttatgtacaaaagaaaa |
116 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||| |||||||||| ||| |
|
|
| T |
14178478 |
aaatggaaagacctacatataaatgcatttatcatctgtaaagagaattttaagatacttgaaaggaattgtcaattttgaagttctgtacaaaagtaaa |
14178577 |
T |
|
| Q |
117 |
gagaatgttagcttgacaggatggtttgactcggataatacatgagatacatatgacag-aaagagcacttcagggta |
193 |
Q |
| |
|
||||| ||||||||||| |||||| |||||| ||||||||| |||||||||||||||| ||||||||||||| |||| |
|
|
| T |
14178578 |
gagaacgttagcttgactcgatggtctgactcagataatacaggagatacatatgacagaaaagagcacttcatggta |
14178655 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University