View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14311_low_6 (Length: 208)
Name: NF14311_low_6
Description: NF14311
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14311_low_6 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 1 - 187
Target Start/End: Original strand, 1581893 - 1582078
Alignment:
| Q |
1 |
tcatctcaatcagatgatgaacgagccccacaagggcctttcactagaagaatcagagagacttgaaaccccttgggattagagaaaccttcctagatgg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||| |
|
|
| T |
1581893 |
tcatctcaatcagatgatgaacgagccccacaagg-cctttcactagaagaatcagagagacttgaaaccctttgggattagagaaacctccctagatgg |
1581991 |
T |
 |
| Q |
101 |
agacatatgacgggaccacaaatcccaacgaaacgaatcgaaaggatcgagggagtgttcgaagaacacagcgaaaacatcatggca |
187 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||| ||| ||||||||||| | ||||||| ||||||||||| |||| |
|
|
| T |
1581992 |
agacatatgacgggaccacaaatcccaacgaaacaaatcgaaagcatcaagggagtgttcaacgaacacatcgaaaacatcaaggca |
1582078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University