View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14312_high_25 (Length: 206)
Name: NF14312_high_25
Description: NF14312
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14312_high_25 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 11 - 179
Target Start/End: Original strand, 37190140 - 37190308
Alignment:
| Q |
11 |
cacagaaattatggtgaactactgtgattttgcaagagctacatatactttgggcaaaattgtgatggctaaccatgattctgtcaaaccatgaattact |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
37190140 |
cacagaaattatggtgaactactgtgattttgcaagaactacatatactttgggcaaaattgtgatggctaaccatgattctgtcaaaccatgaattgct |
37190239 |
T |
 |
| Q |
111 |
gtaattgaaattatatcagaggtggattctacttactatgtggcccctgtctaggagcagaggttgttg |
179 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37190240 |
gtaattgaaattatatcagaggtggattctacttactatgtggcccctgtctaggagcagaggttgttg |
37190308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University