View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14312_high_25 (Length: 206)

Name: NF14312_high_25
Description: NF14312
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14312_high_25
NF14312_high_25
[»] chr1 (1 HSPs)
chr1 (11-179)||(37190140-37190308)


Alignment Details
Target: chr1 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 11 - 179
Target Start/End: Original strand, 37190140 - 37190308
Alignment:
11 cacagaaattatggtgaactactgtgattttgcaagagctacatatactttgggcaaaattgtgatggctaaccatgattctgtcaaaccatgaattact 110  Q
    ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||    
37190140 cacagaaattatggtgaactactgtgattttgcaagaactacatatactttgggcaaaattgtgatggctaaccatgattctgtcaaaccatgaattgct 37190239  T
111 gtaattgaaattatatcagaggtggattctacttactatgtggcccctgtctaggagcagaggttgttg 179  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
37190240 gtaattgaaattatatcagaggtggattctacttactatgtggcccctgtctaggagcagaggttgttg 37190308  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University