View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14312_high_26 (Length: 206)
Name: NF14312_high_26
Description: NF14312
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14312_high_26 |
 |  |
|
| [»] scaffold0391 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr8 (Bit Score: 172; Significance: 1e-92; HSPs: 4)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 15 - 190
Target Start/End: Complemental strand, 33975576 - 33975401
Alignment:
| Q |
15 |
aatatacgggcagcaagctgttgaggattttgtttaacacacaatctcataaactttgaaaatatacgggtcatcaagccttgctgcttctccgcgagcc |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33975576 |
aatatacgggcagcaagctgttgaggattttgtttaacacacaatctcataaactttgaaaatatacgggtcatcaagccttgctgcttctccgcgagcc |
33975477 |
T |
 |
| Q |
115 |
cacttttattgttattcatgtcaataatcagtctttttctttgctcaattggttccttggtgctttggtaaattcc |
190 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
33975476 |
cacttttattgttattcatgtcaataatcagtctttttctttgctcaaatggttccttggtgctttggtaaattcc |
33975401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 15 - 190
Target Start/End: Complemental strand, 33960276 - 33960101
Alignment:
| Q |
15 |
aatatacgggcagcaagctgttgaggattttgtttaacacacaatctcataaactttgaaaatatacgggtcatcaagccttgctgcttctccgcgagcc |
114 |
Q |
| |
|
||||||||||||| |||||||||||||| |||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
33960276 |
aatatacgggcagtgagctgttgaggattccgtttaacacacaatctcataaactttgacaatatacaggtcatcaagccttgctgcttctccgcgagcc |
33960177 |
T |
 |
| Q |
115 |
cacttttattgttattcatgtcaataatcagtctttttctttgctcaattggttccttggtgctttggtaaattcc |
190 |
Q |
| |
|
|||||||||| ||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
33960176 |
cacttttatttttattaatgtcaataatcagtctttttctttgctcaaatggttccttggtgctttggtaaattcc |
33960101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 136; E-Value: 4e-71
Query Start/End: Original strand, 15 - 190
Target Start/End: Complemental strand, 33952970 - 33952795
Alignment:
| Q |
15 |
aatatacgggcagcaagctgttgaggattttgtttaacacacaatctcataaactttgaaaatatacgggtcatcaagccttgctgcttctccgcgagcc |
114 |
Q |
| |
|
||||||||||||| |||||||||||||| |||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
33952970 |
aatatacgggcagtgagctgttgaggattccgtttaacacacaatctcataaactttgacaatatacaggtcatcaagccttgctgcttctccgcgagcc |
33952871 |
T |
 |
| Q |
115 |
cacttttattgttattcatgtcaataatcagtctttttctttgctcaattggttccttggtgctttggtaaattcc |
190 |
Q |
| |
|
|||||||||| ||||| ||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||| |
|
|
| T |
33952870 |
cacttttatttttattaatgtcaataatcagtctttttctttgctcaaatggttccttggcgctttggtaaattcc |
33952795 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 111; E-Value: 3e-56
Query Start/End: Original strand, 24 - 190
Target Start/End: Complemental strand, 33992480 - 33992314
Alignment:
| Q |
24 |
gcagcaagctgttgaggattttgtttaacacacaatctcataaactttgaaaatatacgggtcatcaagccttgctgcttctccgcgagcccacttttat |
123 |
Q |
| |
|
|||||||||||||| ||||||||||||| |||||||||||| | ||||| ||||||||||||| ||||| ||||||||||||||||||| ||||| ||| |
|
|
| T |
33992480 |
gcagcaagctgttggggattttgtttaatacacaatctcattacttttgacaatatacgggtcaacaagctttgctgcttctccgcgagctcacttctat |
33992381 |
T |
 |
| Q |
124 |
tgttattcatgtcaataatcagtctttttctttgctcaattggttccttggtgctttggtaaattcc |
190 |
Q |
| |
|
| ||||| ||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||| |
|
|
| T |
33992380 |
ttttattaatgtcaataatcagtctttttctttgctcaaatggttgcttggtgctttggtaaattcc |
33992314 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 132; Significance: 9e-69; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 132; E-Value: 9e-69
Query Start/End: Original strand, 15 - 190
Target Start/End: Original strand, 8277786 - 8277961
Alignment:
| Q |
15 |
aatatacgggcagcaagctgttgaggattttgtttaacacacaatctcataaactttgaaaatatacgggtcatcaagccttgctgcttctccgcgagcc |
114 |
Q |
| |
|
|||||||||||||| | ||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
8277786 |
aatatacgggcagcgaaatgttgaggattttgtttaacacaaaatctcataaactttgacaatatacgggtcatcaaaccttgctgcttctccgcgagcc |
8277885 |
T |
 |
| Q |
115 |
cacttttattgttattcatgtcaataatcagtctttttctttgctcaattggttccttggtgctttggtaaattcc |
190 |
Q |
| |
|
|||||||||| |||||| |||||||||||||| ||| ||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
8277886 |
cacttttatttttattcttgtcaataatcagtttttctctttgctcaaatggttccttggtgctttggtaaattcc |
8277961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0391 (Bit Score: 47; Significance: 5e-18; HSPs: 1)
Name: scaffold0391
Description:
Target: scaffold0391; HSP #1
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 15 - 190
Target Start/End: Complemental strand, 12527 - 12346
Alignment:
| Q |
15 |
aatatacgggcagcaagctgttgaggattttgtttaacacacaatctcataaactttgaaaatatacgggtcatcaagccttgctgcttctccgcga--- |
111 |
Q |
| |
|
|||||||||||||| |||||||| |||||||||||||||||||| ||| || ||||| ||||||| ||||||| || ||| ||||||||| | | |
|
|
| T |
12527 |
aatatacgggcagcgagctgttgcagattttgtttaacacacaatgtcagaagttttgacaatatacaagtcatcaggctttgatgcttctcccctaaac |
12428 |
T |
 |
| Q |
112 |
---gcccacttttattgttattcatgtcaataatcagtctttttctttgctcaattggttccttggtgctttggtaaattcc |
190 |
Q |
| |
|
| || ||| || | |||||||||||||||||| |||||||| | |||||||||||| || |||| |||||||||||| |
|
|
| T |
12427 |
accgttcatgtttgttttcattcatgtcaataatcagcctttttctcttctcaattggttctttagtgcattggtaaattcc |
12346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University