View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14312_low_15 (Length: 307)
Name: NF14312_low_15
Description: NF14312
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14312_low_15 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 268; Significance: 1e-149; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 268; E-Value: 1e-149
Query Start/End: Original strand, 17 - 296
Target Start/End: Complemental strand, 24334976 - 24334697
Alignment:
| Q |
17 |
atatctttcttactcaaattcttctattttatgttagtttaatttatatggtttctgtgattttttgcatgaagaatttgttggagtaagacattaatct |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
24334976 |
atatctttcttactcaaattcttctattttatgttagtttaatttatatggtttctgtgattttttgcatgacgaatttgttggagtaagacattaatct |
24334877 |
T |
 |
| Q |
117 |
gtgtaaacaaagtttagtttttaattatttgttttgatgaaaatttcaatttttcaagtgatataacagtttggattggattcacataaggggtttgaac |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
24334876 |
gtgtaaacaaagtttagtttttaattatttgttttgatgaaaatttcaatttttcaagtgatataacagtttggattggattcgcataaggggtttgaac |
24334777 |
T |
 |
| Q |
217 |
tttgatcttgcaccaattggtggatcatgtatggcccactttgtgtttctcacgttcttctttgatatgctactagaatt |
296 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
24334776 |
tttgatcttgcaccaattggtggatcatgtatggcccactttgtgtttctcatgttcttctttgatatgctactagaatt |
24334697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University