View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14312_low_16 (Length: 305)
Name: NF14312_low_16
Description: NF14312
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14312_low_16 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 280; Significance: 1e-157; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 280; E-Value: 1e-157
Query Start/End: Original strand, 6 - 289
Target Start/End: Complemental strand, 43935454 - 43935171
Alignment:
| Q |
6 |
catagggtttagaaaatggtttgggaacaagatgtgttcaaaactacaaaaagaatttcagattccactaaaatactttatagttttgaagatatctgtt |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43935454 |
catagggtttagaaaatggtttgggaacaagatgtgttcaaaactacaaaaagaatttcagattccactaaaatactttatagttttgaagatatctgtt |
43935355 |
T |
|
| Q |
106 |
ctcacactagcaccattgttgaaacttgaatttctgttggtgtttttatggcagtttagcatattagcatgctccagttttatgcctaataaagaacgca |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
43935354 |
ctcacactagcaccattgttgaaacttgaatttctgttggtgtttttatggcagtttagcatattagcatgctccagttttatgcctagtaaagaacgca |
43935255 |
T |
|
| Q |
206 |
ttaaggacattatcttgaatagtgacattttattgcacataacatggaattagccgggaaaatttggcctagcgaatttgttgc |
289 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43935254 |
ttaaggacattatcttgaatagtgacattttattgcacataacatggaattagccgggaaaatttggcctagcgaatttgttgc |
43935171 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University