View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14312_low_22 (Length: 244)
Name: NF14312_low_22
Description: NF14312
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14312_low_22 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 168; Significance: 4e-90; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 10 - 226
Target Start/End: Complemental strand, 360160 - 359956
Alignment:
| Q |
10 |
tcgaagaatatatgtcggtaagatcaatattgtgttaaatatatgacattttcgtgtcgttgctcgaagcatatattattgacaataaattgagatatgt |
109 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
360160 |
tcgaagcatatatgtcggtaagatcaatattgtgttaaatatatgacattttcgtgtcgttgctcgaagcatatattattgacaataaattgagttat-- |
360063 |
T |
|
| Q |
110 |
atgcatgtatatttaatttaatatgaaattttcatttctttacagttctagttggattggttgctgtaagcttcccattttttggaggcttgttagggtt |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
360062 |
----------atttaatttaatatgaaattttcatttctttacagttctagttggattggttgctgtaagcttcccattttttggaggcttgttagggtt |
359973 |
T |
|
| Q |
210 |
ttttggaggactagcat |
226 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
359972 |
ttttggaggactagcat |
359956 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University