View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14312_low_23 (Length: 238)
Name: NF14312_low_23
Description: NF14312
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14312_low_23 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 80; Significance: 1e-37; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 138 - 221
Target Start/End: Complemental strand, 32977275 - 32977192
Alignment:
| Q |
138 |
cttaactgcttagtctaacgtcagtgacataggcatcatggcatcacttgaaaccatggtgctggtgtgcttggtcatgtcaac |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
32977275 |
cttaactgcttagtctaacgtcagtgacataggcatcatggcatcacttgaaaccatggtgctagtgtgcttggtcatgtcaac |
32977192 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 6 - 50
Target Start/End: Complemental strand, 32977413 - 32977369
Alignment:
| Q |
6 |
aaaaaacaactctaaaggatcatatttcttaagaaaattaatata |
50 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
32977413 |
aaaaaacaactctaatggatcatatttcttaagaaaattaatata |
32977369 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University