View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14312_low_24 (Length: 208)
Name: NF14312_low_24
Description: NF14312
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14312_low_24 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 170; Significance: 2e-91; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 20 - 193
Target Start/End: Original strand, 49871270 - 49871443
Alignment:
| Q |
20 |
aaatcgatcattacaacttacaacttaggaacagatgctaaatattaaacattgcattagtaacttactgaatgttgcggtattgtaagtctgcacacca |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49871270 |
aaatcgatcattacaacttacaacttaggaacagatgctaaatattaatcattgcattagtaacttactgaatgttgcggtattgtaagtctgcacacca |
49871369 |
T |
|
| Q |
120 |
tcaccatagcttttgctaccagtaaatatggtctttttgggaccatcaccaataatagtaacatggtccctatg |
193 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49871370 |
tcaccatagcttttgctaccagtaaatatggtctttttgggaccatcaccaataatagtaacatggtccctatg |
49871443 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 77 - 192
Target Start/End: Original strand, 49865396 - 49865511
Alignment:
| Q |
77 |
tagtaacttactgaatgttgcggtattgtaagtctgcacaccatcaccatagcttttgctaccagtaaatatggtctttttgggaccatcaccaataata |
176 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||| |||||||||| ||||||||| |
|
|
| T |
49865396 |
tagtaacttaccgaatgttgcggtattgtaagtctgcacaccatcagcatagcttttgctgccagtaaatatggtctttgtgggaccatcgccaataata |
49865495 |
T |
|
| Q |
177 |
gtaacatggtccctat |
192 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
49865496 |
gtaacatggtccctat |
49865511 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University