View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14313_high_12 (Length: 300)
Name: NF14313_high_12
Description: NF14313
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14313_high_12 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 244; Significance: 1e-135; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 1 - 284
Target Start/End: Original strand, 49940695 - 49940980
Alignment:
| Q |
1 |
ctaggacacaacaagggaggtgggtgagtgcaatataaccacactcaatggaatagaataggattcaataaaaataacatataattttataggatatttt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49940695 |
ctaggacacaacaagggaggtgggtgagtgcaatataaccacactcaatggaatagaatcggattcaataaaaataacatataattttataggatatttt |
49940794 |
T |
 |
| Q |
101 |
atgatagaataaaaggaagttttccatttcgttatttgtcagtgaacaacatggtaaggagattagttaacattaagttggctgctggttccatccaaca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49940795 |
atgatagaataaaaggaagttttccatttcgttatttgtcagtgaacaacatggtaaggagattagttaacattaagttggctgctggttccatccaaca |
49940894 |
T |
 |
| Q |
201 |
actccaaattcaggggaggagaa--agnnnnnnnnngaggtgtgttgtatgaaatggaatagattctgttgagctcgattccacct |
284 |
Q |
| |
|
||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49940895 |
actccaaattcaggggaggagaaagagaaaaaaaaagaggtgtgttgtatgaaatggaatagattctgttgagctcgattccacct |
49940980 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University