View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14313_high_13 (Length: 295)
Name: NF14313_high_13
Description: NF14313
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14313_high_13 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 47; Significance: 7e-18; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 146 - 196
Target Start/End: Complemental strand, 45527581 - 45527531
Alignment:
| Q |
146 |
tatttatgaatgtaattgagctcgagtgttgacgagttccaaattctttgt |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
45527581 |
tatttatgaatgtaattgagctcgagtgttaacgagttccaaattctttgt |
45527531 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 9 - 48
Target Start/End: Original strand, 45527701 - 45527740
Alignment:
| Q |
9 |
agattaatcttctctttaaagtatttgagatcaatttaat |
48 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45527701 |
agattaatcttctctttaaagtatttgagatcaatttaat |
45527740 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University