View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14313_low_14 (Length: 295)

Name: NF14313_low_14
Description: NF14313
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14313_low_14
NF14313_low_14
[»] chr1 (2 HSPs)
chr1 (146-196)||(45527531-45527581)
chr1 (9-48)||(45527701-45527740)


Alignment Details
Target: chr1 (Bit Score: 47; Significance: 7e-18; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 146 - 196
Target Start/End: Complemental strand, 45527581 - 45527531
Alignment:
146 tatttatgaatgtaattgagctcgagtgttgacgagttccaaattctttgt 196  Q
    |||||||||||||||||||||||||||||| ||||||||||||||||||||    
45527581 tatttatgaatgtaattgagctcgagtgttaacgagttccaaattctttgt 45527531  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 9 - 48
Target Start/End: Original strand, 45527701 - 45527740
Alignment:
9 agattaatcttctctttaaagtatttgagatcaatttaat 48  Q
    ||||||||||||||||||||||||||||||||||||||||    
45527701 agattaatcttctctttaaagtatttgagatcaatttaat 45527740  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University