View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14313_low_18 (Length: 236)
Name: NF14313_low_18
Description: NF14313
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14313_low_18 |
 | |
|
| [»] scaffold0332 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0332 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: scaffold0332
Description:
Target: scaffold0332; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 14 - 220
Target Start/End: Complemental strand, 6291 - 6083
Alignment:
| Q |
14 |
caaagggaatgaaaattcaatagaagaaaatgactgtccatattctttcttggactgatataataacagggggaatcattttctgctatcta--agtata |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
6291 |
caaagggaatgaaaattcaatagaagaaaatgactgtccatattctttcttggactgatataataacagggggaatcattttctgctatctataagtata |
6192 |
T |
|
| Q |
112 |
gtgcaaagtgaatccatagaaagcaatgatcgtgtaggtgcagtctgtgcataaaatacaaactgtgaccctagaaacacacattaaaactattgaggga |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6191 |
gtgcaaagtgaatccatagaaagcaatgatcgtgtaggtgcagtctgtgcataaaatacgaactgtgaccctagaaacacacattaaaactattgaggga |
6092 |
T |
|
| Q |
212 |
tggttttat |
220 |
Q |
| |
|
||||||||| |
|
|
| T |
6091 |
tggttttat |
6083 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University