View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14313_low_19 (Length: 227)
Name: NF14313_low_19
Description: NF14313
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14313_low_19 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 146; Significance: 5e-77; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 146; E-Value: 5e-77
Query Start/End: Original strand, 1 - 175
Target Start/End: Original strand, 27661760 - 27661938
Alignment:
| Q |
1 |
ataattattagtccaaaaaatgactgctttaactaaagtatgagtatccatatttgtttgcagcttaataaacttgacataaaagt----aaatacaaag |
96 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
27661760 |
ataattattagtccaaaaaatgaccgctttaactaaagtatgagtattcatatttgtttgcagcttaataaacttgacataaaagtaagtaaatacaaag |
27661859 |
T |
 |
| Q |
97 |
acaacaaacttttaatttgtgaaaataaaccaccaaactttgatatacttgtgaatcactctcataaatatgacatgct |
175 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||| |
|
|
| T |
27661860 |
acaacaaacttttaatttgtgaaaataaaccaccaaactttgatatatttgtgaatcactctcataaatctgacatgct |
27661938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University