View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14314_high_15 (Length: 240)
Name: NF14314_high_15
Description: NF14314
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14314_high_15 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 148; Significance: 3e-78; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 1 - 204
Target Start/End: Complemental strand, 2741673 - 2741471
Alignment:
| Q |
1 |
attttaattgtgttgaagttttttagtatggcggaatttttgtaaagcatactggtattttataacaaacatcatagttcattggtaaagtttgaaattt |
100 |
Q |
| |
|
||||||||||||||||||||||| |||| |||| ||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
2741673 |
attttaattgtgttgaagttttt-agtacggcgaaatttttgtaaagtatactggtattttataacaaaaatcatagttcattggtaaagtttgaaattc |
2741575 |
T |
 |
| Q |
101 |
ttggaccaaatcatctctcacttttatatatcaaaatgatcactattgatcagctatccaaactccattaacccaaatttcacccaaacctctggaatga |
200 |
Q |
| |
|
| || ||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
2741574 |
tgttactaaatcgtctctcacttttatataacaaaatgatcactattgatcagctatccaaactccattaacccaaatttcactcaaacctctggaatga |
2741475 |
T |
 |
| Q |
201 |
acat |
204 |
Q |
| |
|
|||| |
|
|
| T |
2741474 |
acat |
2741471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University