View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14314_low_12 (Length: 258)

Name: NF14314_low_12
Description: NF14314
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14314_low_12
NF14314_low_12
[»] chr8 (1 HSPs)
chr8 (2-236)||(40863075-40863312)


Alignment Details
Target: chr8 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 2 - 236
Target Start/End: Original strand, 40863075 - 40863312
Alignment:
2 tgaaaaaataatagcctcttcacatagtaatttgaaattatatcttggttatgatctttccactgaaacttgtaagctggtagcattcggtgtggagttg 101  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40863075 tgaaaaaataatagcctcttcacatagtaatttgaaattatatcttggttatgatctttccactgaaacttgtaagctggtagcattcggtgtggagttg 40863174  T
102 gacggtaggaaa---aatgcaacaagcaagtgtggtgtaagttttcagtttcggggataatatattcaacacttacccgtgtctctactttttaggctta 198  Q
    ||||||||||||   |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||    
40863175 gacggtaggaaaaataatgcaacaagcaagtgtggtgaaagttttcagtttcggggataatatattcaacacttactcgtgtctctactttttaggctta 40863274  T
199 attatgttcgcaacaatggtgtttattttagtgatact 236  Q
    ||||||||||||||||||||||||||||||||| ||||    
40863275 attatgttcgcaacaatggtgtttattttagtggtact 40863312  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University