View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14314_low_12 (Length: 258)
Name: NF14314_low_12
Description: NF14314
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14314_low_12 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 2 - 236
Target Start/End: Original strand, 40863075 - 40863312
Alignment:
| Q |
2 |
tgaaaaaataatagcctcttcacatagtaatttgaaattatatcttggttatgatctttccactgaaacttgtaagctggtagcattcggtgtggagttg |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40863075 |
tgaaaaaataatagcctcttcacatagtaatttgaaattatatcttggttatgatctttccactgaaacttgtaagctggtagcattcggtgtggagttg |
40863174 |
T |
 |
| Q |
102 |
gacggtaggaaa---aatgcaacaagcaagtgtggtgtaagttttcagtttcggggataatatattcaacacttacccgtgtctctactttttaggctta |
198 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
40863175 |
gacggtaggaaaaataatgcaacaagcaagtgtggtgaaagttttcagtttcggggataatatattcaacacttactcgtgtctctactttttaggctta |
40863274 |
T |
 |
| Q |
199 |
attatgttcgcaacaatggtgtttattttagtgatact |
236 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
40863275 |
attatgttcgcaacaatggtgtttattttagtggtact |
40863312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University