View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14314_low_18 (Length: 238)
Name: NF14314_low_18
Description: NF14314
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14314_low_18 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 98; Significance: 2e-48; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 116 - 221
Target Start/End: Complemental strand, 33189767 - 33189662
Alignment:
| Q |
116 |
ttggttgagttaatgagtttaattgagttcacaaattcggatcgagtcgagttcaagctaaaataagtgttcatatcgaacttgaatcaaatttcatacc |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
33189767 |
ttggttgagttaatgagtttaattgagttcacaaattcggatcgagtcgagttcaggctaaaataagtgttcatatcgaacttgaatcaaatttcatgcc |
33189668 |
T |
|
| Q |
216 |
aaacca |
221 |
Q |
| |
|
|||||| |
|
|
| T |
33189667 |
aaacca |
33189662 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 1 - 62
Target Start/End: Complemental strand, 33189878 - 33189817
Alignment:
| Q |
1 |
ctccttattccttaactcaaactatttgagccacccaactcacccctaccccgtatttcatc |
62 |
Q |
| |
|
|||||||||||||||||||||||| | ||||||||||||||||||| ||||| ||||||||| |
|
|
| T |
33189878 |
ctccttattccttaactcaaactagtcgagccacccaactcacccccaccccctatttcatc |
33189817 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University