View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14315_high_38 (Length: 254)
Name: NF14315_high_38
Description: NF14315
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14315_high_38 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 20 - 225
Target Start/End: Original strand, 8483598 - 8483804
Alignment:
| Q |
20 |
gaacagaagtgtggggggaaagcaaaa-ggcatagcgtgaagaagcaagtatgtatgacattgccaagaagcaaagccacagcttgtgaaggaatgatag |
118 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8483598 |
gaacagaagtgtggggggaaagcaaaaaggcatagcgtgaagaagcaagtatgtatgacattgccaagaagcaaagccacagcttgtgaaggaatgatag |
8483697 |
T |
|
| Q |
119 |
aaaagagagggggagtgaggtaagcaggcttaccccactgaggagtgtttgggagtgcaagtaagaaagcttgctaaattatttcactagtatatatata |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||| |
|
|
| T |
8483698 |
aaaagagagggggagtgaggtaagcaggcttaccccactgaggagtgtttgggagtgcaagtaagaaaggttgctaaagtatttcactagtatatatata |
8483797 |
T |
|
| Q |
219 |
gtcatat |
225 |
Q |
| |
|
||||||| |
|
|
| T |
8483798 |
gtcatat |
8483804 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University