View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14315_high_43 (Length: 239)
Name: NF14315_high_43
Description: NF14315
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14315_high_43 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 129; Significance: 7e-67; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 129; E-Value: 7e-67
Query Start/End: Original strand, 86 - 230
Target Start/End: Original strand, 26377451 - 26377595
Alignment:
| Q |
86 |
atgtgaccggaggaagtaagtgtttgtcaatttaccaaacgaaagggatacaaactttttcaaatatgtttcacatgtgtgaaattggaccatgtgggct |
185 |
Q |
| |
|
||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
26377451 |
atgtgaccggaggaaatacatgtttgtcaatttaccaaacgaaagggatacaaactttttcaaatatgtttcgcatgtgtgaaattggaccatgtgggct |
26377550 |
T |
|
| Q |
186 |
aattgatcaaacaattgttttgtgccaaactttggatgatgatgt |
230 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26377551 |
aattgatcaaacaattgttttgtgccaaactttggatgatgatgt |
26377595 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 38 - 89
Target Start/End: Original strand, 26377373 - 26377424
Alignment:
| Q |
38 |
aactaatgtatccagtcataattataggtcagatgcattacatattcaatgt |
89 |
Q |
| |
|
||||||||||||| |||||||||||||| |||||||||||||||||||||| |
|
|
| T |
26377373 |
aactaatgtatccggtcataattataggctagatgcattacatattcaatgt |
26377424 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 38 - 71
Target Start/End: Original strand, 18147860 - 18147893
Alignment:
| Q |
38 |
aactaatgtatccagtcataattataggtcagat |
71 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
18147860 |
aactaatgtatccagtcataattataggtcagat |
18147893 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 58; Significance: 2e-24; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 141 - 230
Target Start/End: Complemental strand, 366210 - 366121
Alignment:
| Q |
141 |
tttttcaaatatgtttcacatgtgtgaaattggaccatgtgggctaattgatcaaacaattgttttgtgccaaactttggatgatgatgt |
230 |
Q |
| |
|
|||||||||||||| | ||| |||||||||||||||||| ||||||||||||| ||||||| ||||||||||| |||||| ||||||||| |
|
|
| T |
366210 |
tttttcaaatatgtctgacaagtgtgaaattggaccatgggggctaattgatccaacaattattttgtgccaagctttgggtgatgatgt |
366121 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 38 - 89
Target Start/End: Original strand, 24419582 - 24419633
Alignment:
| Q |
38 |
aactaatgtatccagtcataattataggtcagatgcattacatattcaatgt |
89 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||| ||||| |||||||||| |
|
|
| T |
24419582 |
aactaatgtatccagtcataattataagtcagatacattaattattcaatgt |
24419633 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University