View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14315_high_46 (Length: 232)
Name: NF14315_high_46
Description: NF14315
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14315_high_46 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 1 - 214
Target Start/End: Complemental strand, 6040428 - 6040215
Alignment:
| Q |
1 |
gatgttgagaagagtgcctttgattcaaaaccttcatatgatgaaactgccatggatttcttcattgaaatctatgataatgagaaaaaggatgcagaat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6040428 |
gatgttgagaagagtgcctttgattcaaaaccttcatatgatgaaactgccatggatttcttcattgaaatctatgataatgagaaaaaggatgcagaat |
6040329 |
T |
|
| Q |
101 |
caacaggtgaagaagtaattggaaaaatcgattttctcgaagaggttgaggatcatggggatatcatcaagtctacaattgaaaatgatggcatcgaagt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
6040328 |
caacaggtgaagaagtaattggaaaaatcgattttctcgaagaggttgaggatcatgaagatatcatcaagtctacaattgaaaatgatggcatagaagt |
6040229 |
T |
|
| Q |
201 |
aggatttatgaaag |
214 |
Q |
| |
|
||||||||||||| |
|
|
| T |
6040228 |
gggatttatgaaag |
6040215 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University