View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14315_high_47 (Length: 216)
Name: NF14315_high_47
Description: NF14315
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14315_high_47 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 18 - 201
Target Start/End: Complemental strand, 35025871 - 35025688
Alignment:
| Q |
18 |
tatataacaaaaaattgatgtacaatgaaaattttgtagtgtatgtattttttgatcaataatgagcttggcaaaatcactatgtaagttattataagat |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
35025871 |
tatataacaaaaaattgatgtacaatgaaaattttgtagtgtatgtattttttgatcaataatgagcttggcaaaatcactatgtaagtgattataagat |
35025772 |
T |
 |
| Q |
118 |
gcattaaaaaatataatttcatctaattaggcagcttggcctaatctctattgaagaaagacaaggaatattattatagaatta |
201 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35025771 |
gcattaaaaaatataatttcatctaagtaggcaggttggcctaatctctattgaagaaagacaaggaatattattatagaatta |
35025688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University