View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14315_high_48 (Length: 216)
Name: NF14315_high_48
Description: NF14315
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14315_high_48 |
 |  |
|
| [»] scaffold0608 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: chr1 (Bit Score: 179; Significance: 9e-97; HSPs: 4)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 179; E-Value: 9e-97
Query Start/End: Original strand, 18 - 204
Target Start/End: Complemental strand, 46934364 - 46934178
Alignment:
| Q |
18 |
tagccacctatgtcaacattcctctcagctttccgtggtagtaaaagtggcactggcgggtgcaatcgaagtgtctcttttattattgcctgtaagtatg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46934364 |
tagccacctatgtcaacattcctctcagctttccgtggtagtaaaagtggcactggcgggtgcaatcgaagtgtctcttttattattgcctgtaagtatg |
46934265 |
T |
 |
| Q |
118 |
ggagccttgaaatatctgactcctcaagtgggacactacaaccaatcatttgccctaactcttttttggccttcaacatagcttctg |
204 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
46934264 |
ggagctttgaaatatctgactcctcaagtgggacactacaaccaatcattttccctaactcttttttggccttcaacatagcttctg |
46934178 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 18 - 153
Target Start/End: Original strand, 11106578 - 11106713
Alignment:
| Q |
18 |
tagccacctatgtcaacattcctctcagctttccgtggtagtaaaagtggcactggcgggtgcaatcgaagtgtctcttttattattgcctgtaagtatg |
117 |
Q |
| |
|
||||||| ||| ||||||| ||||||||||| | ||||||||||| ||| ||||| || ||| || ||||||||||||||||||||| |||||||||| |
|
|
| T |
11106578 |
tagccacatatctcaacatctctctcagcttttcttggtagtaaaaatggaactggtggatgctttctaagtgtctcttttattattgcatgtaagtatg |
11106677 |
T |
 |
| Q |
118 |
ggagccttgaaatatctgactcctcaagtgggacac |
153 |
Q |
| |
|
|||| | || |||| |||||| |||||||| |||| |
|
|
| T |
11106678 |
ggagattagagatatttgactcttcaagtggcacac |
11106713 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 18 - 121
Target Start/End: Complemental strand, 11112908 - 11112805
Alignment:
| Q |
18 |
tagccacctatgtcaacattcctctcagctttccgtggtagtaaaagtggcactggcgggtgcaatcgaagtgtctcttttattattgcctgtaagtatg |
117 |
Q |
| |
|
||||||| ||| ||||||| ||||||||||| | ||||||||||| ||| ||||| || ||| || ||||||||||||||||||||| |||||||||| |
|
|
| T |
11112908 |
tagccacatatctcaacatctctctcagcttttcttggtagtaaaaatggaactggtggatgctttctaagtgtctcttttattattgcatgtaagtatg |
11112809 |
T |
 |
| Q |
118 |
ggag |
121 |
Q |
| |
|
|||| |
|
|
| T |
11112808 |
ggag |
11112805 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 18 - 163
Target Start/End: Complemental strand, 46927494 - 46927349
Alignment:
| Q |
18 |
tagccacctatgtcaacattcctctcagctttccgtggtagtaaaagtggcactggcgggtgcaatcgaagtgtctcttttattattgcctgtaagtatg |
117 |
Q |
| |
|
||||||| ||| |||||||| ||||||||||| || || ||||||| ||| ||||| || ||| ||||||||| |||||||| ||||| | |||||||| |
|
|
| T |
46927494 |
tagccacttatctcaacatttctctcagcttttcggggcagtaaaaatggaactggtggatgctttcgaagtgtttcttttataattgcatttaagtatg |
46927395 |
T |
 |
| Q |
118 |
ggagccttgaaatatctgactcctcaagtgggacactacaaccaat |
163 |
Q |
| |
|
||||| | |||| |||||| |||||||| |||| ||| ||||| |
|
|
| T |
46927394 |
ggagctcagtgatatttgactcttcaagtggcacaccacacccaat |
46927349 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0608 (Bit Score: 47; Significance: 5e-18; HSPs: 2)
Name: scaffold0608
Description:
Target: scaffold0608; HSP #1
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 39 - 153
Target Start/End: Complemental strand, 8320 - 8206
Alignment:
| Q |
39 |
ctctcagctttccgtggtagtaaaagtggcactggcgggtgcaatcgaagtgtctcttttattattgcctgtaagtatgggagccttgaaatatctgact |
138 |
Q |
| |
|
||||||||||| | ||||||||||| ||| ||||| || ||| || ||||||||||||||||||||| |||||||||||||| | || |||| ||||| |
|
|
| T |
8320 |
ctctcagcttttcttggtagtaaaaatggaactggtggatgctttctaagtgtctcttttattattgcatgtaagtatgggagattagagatatttgact |
8221 |
T |
 |
| Q |
139 |
cctcaagtgggacac |
153 |
Q |
| |
|
| |||||||| |||| |
|
|
| T |
8220 |
cttcaagtggcacac |
8206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0608; HSP #2
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 21 - 121
Target Start/End: Original strand, 2016 - 2116
Alignment:
| Q |
21 |
ccacctatgtcaacattcctctcagctttccgtggtagtaaaagtggcactggcgggtgcaatcgaagtgtctcttttattattgcctgtaagtatggga |
120 |
Q |
| |
|
|||| ||| ||||||| ||||||||||| | ||||||||||| ||| ||||| || ||| || ||||||||||||||||||||| ||||||||||||| |
|
|
| T |
2016 |
ccacatatctcaacatctctctcagcttttcttggtagtaaaaatggaactggtggatgctttctaagtgtctcttttattattgcatgtaagtatggga |
2115 |
T |
 |
| Q |
121 |
g |
121 |
Q |
| |
|
| |
|
|
| T |
2116 |
g |
2116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 69 - 112
Target Start/End: Original strand, 29972665 - 29972708
Alignment:
| Q |
69 |
actggcgggtgcaatcgaagtgtctcttttattattgcctgtaa |
112 |
Q |
| |
|
||||| ||||||||||||| |||||||||||||||||| ||||| |
|
|
| T |
29972665 |
actggagggtgcaatcgaaatgtctcttttattattgcttgtaa |
29972708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University