View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14315_low_21 (Length: 392)
Name: NF14315_low_21
Description: NF14315
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14315_low_21 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 350; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 350; E-Value: 0
Query Start/End: Original strand, 11 - 378
Target Start/End: Original strand, 3209193 - 3209557
Alignment:
| Q |
11 |
attatactcaagaaaagcaaaacaaacccaaagtaatatcccataaccaaaccaaccccaccactcttttcatcaccacctttaggaccaggtgcaccac |
110 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
3209193 |
attaaactcaagaaaagcaaaacaaacccaaagtaatatcccataaccaaaccaaccccaccactcttttcatcacc---tttaggaccaggtgcaccac |
3209289 |
T |
 |
| Q |
111 |
cagtgctatttgcacctcccactgtggtggatcccaccaccgacaacgccgtgaaagcattaagattctccttctcaaacaaatgtttccctggctttcc |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3209290 |
cagtgctatttgcacctcccactgtggtggatcccaccaccgacaacgccgtgaaagcattaagattctccttctcaaacaaatgtttccctggctttcc |
3209389 |
T |
 |
| Q |
211 |
tgcgacaaccggccccacttgccatacctgagtaacattgtccgacttttccggcaacttaactcccgcaaatatcgttataacaccgttagattcttca |
310 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3209390 |
tgcgacaaccggccccacttgccatacctgagtaacattgtccgacttttccggcaacttaactcccgcaaatatcgttataacaccgttagattcttca |
3209489 |
T |
 |
| Q |
311 |
gcagacaacccccatgtttcaacggagaggctttttacttcgttaattccaccgaaggaagttaggtt |
378 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3209490 |
gcagacaacccccatgtttcaacggagaggctttttacttcgttaattccaccgaaggaagttaggtt |
3209557 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University