View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14315_low_23 (Length: 359)
Name: NF14315_low_23
Description: NF14315
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14315_low_23 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 286; Significance: 1e-160; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 286; E-Value: 1e-160
Query Start/End: Original strand, 18 - 345
Target Start/End: Complemental strand, 53023248 - 53022919
Alignment:
| Q |
18 |
aaaagtttgaaatcataatgaggaatttcatccgtactct-gtgcacaaactggtttttgccatttttaagacattgctcaaacactattggggtggg-t |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||| ||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
53023248 |
aaaagtttgaaatcataatgaggaatttcatccttactctcgtgcacaaactcgtttttgtcatttttaagacattgctcaaacactattggggtggggt |
53023149 |
T |
 |
| Q |
116 |
tggggtttaaaactgcacaatctcaatacttgaatgttcaagatatttgatgcatattttgatatatattttatttgcaaatgaatattcttttgtttac |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53023148 |
tggggtttaaaactgcacaatctcaatacttgaatgttcaagatatttgatgcatattttgatatatattttatttgcaaatgaatattcttttgtttac |
53023049 |
T |
 |
| Q |
216 |
ggtaaatacttcgttttataattcaatttagttgtcaacatgtgttaggtttgtcctaattctctccctttcatttagccttctcgatcccgccaaacac |
315 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
53023048 |
ggtaaatacctcgttttataattcaatttagttgtcaacatgtgttaggtttgtcctaattctctccctatcatttagccttcttgatcccgccaaacac |
53022949 |
T |
 |
| Q |
316 |
catctctcgttctccttctacttttcatct |
345 |
Q |
| |
|
||||||||||||||| |||||||||||||| |
|
|
| T |
53022948 |
catctctcgttctccctctacttttcatct |
53022919 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University