View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14315_low_25 (Length: 353)
Name: NF14315_low_25
Description: NF14315
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14315_low_25 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 304; Significance: 1e-171; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 304; E-Value: 1e-171
Query Start/End: Original strand, 22 - 341
Target Start/End: Complemental strand, 586612 - 586293
Alignment:
| Q |
22 |
aatacaatactaagataacaacatacaccatatcatgatgctgtccattgaggtagtactcttcctacagcatttgtaccagttaatttatctaatatga |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| || |
|
|
| T |
586612 |
aatacaatactaagataacaacatacaccatatcatgatgctgtccattgaggtagtactcttcctgcagcatttgtaccagttaatttatctaatacga |
586513 |
T |
 |
| Q |
122 |
cattgtcaatatcgatacagtctaggtcctcgtcaaggcatccatggtaatagtcttcctcttctgattcatatatctcagcctttttaatttgtcgctg |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
586512 |
cattgtcaatatcgatacagtctaggtcctcgtcaaggcatccatggtaatagtcttcctcttctgattcatatatctcagcctttttaatttgtctctt |
586413 |
T |
 |
| Q |
222 |
taccgtccttttcttggagcgaccagtacttttgattaaggcatcatcatcctcaccatttgaatctggcgttctatttgcttctcgtcttcttttggct |
321 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
586412 |
taccgtccttttcttggagcgaccagtacttttgattaaggcatcatcatcctcaccatttgaatctggcgttctatttgcttctcgtcttcttttggct |
586313 |
T |
 |
| Q |
322 |
gaatccacactgcctttgct |
341 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
586312 |
gaatccacactgcctttgct |
586293 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University