View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14315_low_26 (Length: 351)
Name: NF14315_low_26
Description: NF14315
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14315_low_26 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 304; Significance: 1e-171; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 304; E-Value: 1e-171
Query Start/End: Original strand, 24 - 351
Target Start/End: Complemental strand, 25920155 - 25919828
Alignment:
| Q |
24 |
tgccttgcatttatatctccactaatcttaacttagatggagttgatactgatcccatcttttctgaagtcaccactgctatctccacaatcattggaaa |
123 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25920155 |
tgccttgcatttacatctccactaatcttaacttagatggagttgacactgatccaatcttttctgaagtcaccactgctatctccacaatcattggaaa |
25920056 |
T |
 |
| Q |
124 |
accagaaaaggtattcatatatctctcactctttctctttgtttttcatgcaaagtttatgattatgagtttttgctttgtttttgcctaaatccttagt |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||| |
|
|
| T |
25920055 |
accagaaaaggtattcatatatctctcactctttctctttgtttttcatgcaaagtttatgattatgagtttttggtttgtttttgcctaaatcattagt |
25919956 |
T |
 |
| Q |
224 |
tgactttacacaaattatggtgttcaattttatttttcttcttcataatttatgtttcatggttggttgattttaattgaatgattcatgttttttggtt |
323 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25919955 |
tgactttacacaaattatggtgttcaattttatttttcttcttcataatttatgtttcatggttggttgattttaattgaatgattcatgttttttggtt |
25919856 |
T |
 |
| Q |
324 |
agtttaatttgatccaagtcgtttaatt |
351 |
Q |
| |
|
|||||||||||||||||||| ||||||| |
|
|
| T |
25919855 |
agtttaatttgatccaagtcatttaatt |
25919828 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University