View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14315_low_27 (Length: 332)

Name: NF14315_low_27
Description: NF14315
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14315_low_27
NF14315_low_27
[»] chr1 (2 HSPs)
chr1 (1-119)||(17115523-17115641)
chr1 (117-161)||(17115450-17115494)


Alignment Details
Target: chr1 (Bit Score: 95; Significance: 2e-46; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 95; E-Value: 2e-46
Query Start/End: Original strand, 1 - 119
Target Start/End: Complemental strand, 17115641 - 17115523
Alignment:
1 gatacaacttattttggaaaatgattaacacaagtaaaactacatattataggcattttggattcacttctagtttattgatctggtgttaattagatca 100  Q
    |||||||||||||||| ||||||||||||||||||||||||||||| ||||  ||||||||||| | |||||||||||||||||||||||||||||||||    
17115641 gatacaacttattttgaaaaatgattaacacaagtaaaactacataatatacacattttggattaaattctagtttattgatctggtgttaattagatca 17115542  T
101 tatgtattcgaacaaagat 119  Q
    |||||||||||||||||||    
17115541 tatgtattcgaacaaagat 17115523  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 117 - 161
Target Start/End: Complemental strand, 17115494 - 17115450
Alignment:
117 gatgctatgatagctcatggcggaggtaacactccgatgatatta 161  Q
    |||||||||||||||||||||||||||||||||||||||||||||    
17115494 gatgctatgatagctcatggcggaggtaacactccgatgatatta 17115450  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University