View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14315_low_27 (Length: 332)
Name: NF14315_low_27
Description: NF14315
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14315_low_27 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 95; Significance: 2e-46; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 95; E-Value: 2e-46
Query Start/End: Original strand, 1 - 119
Target Start/End: Complemental strand, 17115641 - 17115523
Alignment:
| Q |
1 |
gatacaacttattttggaaaatgattaacacaagtaaaactacatattataggcattttggattcacttctagtttattgatctggtgttaattagatca |
100 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||| |||| ||||||||||| | ||||||||||||||||||||||||||||||||| |
|
|
| T |
17115641 |
gatacaacttattttgaaaaatgattaacacaagtaaaactacataatatacacattttggattaaattctagtttattgatctggtgttaattagatca |
17115542 |
T |
 |
| Q |
101 |
tatgtattcgaacaaagat |
119 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
17115541 |
tatgtattcgaacaaagat |
17115523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 117 - 161
Target Start/End: Complemental strand, 17115494 - 17115450
Alignment:
| Q |
117 |
gatgctatgatagctcatggcggaggtaacactccgatgatatta |
161 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17115494 |
gatgctatgatagctcatggcggaggtaacactccgatgatatta |
17115450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University