View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14315_low_28 (Length: 331)
Name: NF14315_low_28
Description: NF14315
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14315_low_28 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 15 - 242
Target Start/End: Original strand, 47351735 - 47351962
Alignment:
| Q |
15 |
tctcgacagaggatggaaaatgggtggactagaagaactttcttagattattagagtgttaatcaataagagctgataattggaacacatgatttagtat |
114 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
47351735 |
tctcggcagaggatggaaaatgggtggactagaagaactttcttagattattagagagttaatcaataagagcttataattggaacacatgatttagtat |
47351834 |
T |
|
| Q |
115 |
tttaaaccatactcctgctctctagattcgttatattcatccggctttgagtttttaatctgatatgaaaaagtctaatggcgtcacaaattactgtgaa |
214 |
Q |
| |
|
||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47351835 |
tttaaaccatactcctgctttctagattccttatattcatccggctttgagtttttaatctgatatgaaaaagtctaatggcgtcacaaattactgtgaa |
47351934 |
T |
|
| Q |
215 |
gtgattgctttgcaagcttctgttgatt |
242 |
Q |
| |
|
|||||||||| ||||||||||||||||| |
|
|
| T |
47351935 |
gtgattgcttggcaagcttctgttgatt |
47351962 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University