View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14315_low_38 (Length: 262)
Name: NF14315_low_38
Description: NF14315
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14315_low_38 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 174; Significance: 1e-93; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 7 - 204
Target Start/End: Original strand, 19597940 - 19598137
Alignment:
| Q |
7 |
atgctgaaagtatattgaatggttagtgactttagctatatataataatttggttcagtgtttagaagcttcagaaataactgtaactaatttgcataac |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||| |
|
|
| T |
19597940 |
atgctgaaagtatattgaatggttagtgactttagctatatataataatttggttcagtgtttagaagcttcagaaataacaataaccaatttgcataac |
19598039 |
T |
|
| Q |
107 |
ggtatttctaactaatcagttaacaaaacctaacgatctgaataaccgtctcatagaaataccgttataataactgtcttccactagtgttcattaag |
204 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
19598040 |
ggtatttctaactaatcagttaacaaaagctaacgatctgaataaccgtctcatagaaataccgttataataactgtctcacactagtgttcattaag |
19598137 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 225 - 262
Target Start/End: Original strand, 19598158 - 19598195
Alignment:
| Q |
225 |
aaaggattaagattcttaatttggttatgtagttttat |
262 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19598158 |
aaaggattaagattcttaatttggttatgtagttttat |
19598195 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University