View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14315_low_45 (Length: 241)
Name: NF14315_low_45
Description: NF14315
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14315_low_45 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 15 - 226
Target Start/End: Original strand, 38054047 - 38054258
Alignment:
| Q |
15 |
aatattcaatgacagaatattatcaatgattacggtttttgattaatatatcttaagtttttgcttctttgtgcatgtgatattgggttgaagcaaaaat |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38054047 |
aatattcaatgacagaatattatcaatgattacggtttttgattaatatatcttaagtttttgcttctttgtgcatgtgatattgggttgaagcaaaaat |
38054146 |
T |
 |
| Q |
115 |
tgttgaatagtaagaacaagaacttgaaataccatgcgggtgttcggcgtttcttctttgatttaacagtttcaccagcataagagtctgaattatgtga |
214 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38054147 |
tgttgaatagtaagaacaaggacttgaaataccatgcgggtgttcggcgtttcttctttgatttaacagtttcaccagcataagagtctgaattatgtga |
38054246 |
T |
 |
| Q |
215 |
gtacttgtaagt |
226 |
Q |
| |
|
|||||||||||| |
|
|
| T |
38054247 |
gtacttgtaagt |
38054258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University