View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14315_low_52 (Length: 202)
Name: NF14315_low_52
Description: NF14315
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14315_low_52 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 44; Significance: 3e-16; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 103 - 184
Target Start/End: Original strand, 34628142 - 34628223
Alignment:
| Q |
103 |
ttatagaaatgcacttattatctaggacatgannnnnnnnnnggacgaaagctatttcaaccaaactaaggataactgattc |
184 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
34628142 |
ttatagaaatgcacttattatttaggacatgattttttttttggaagaaagctatttcaaccaaactaaggataactgattc |
34628223 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University