View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14315_low_53 (Length: 201)
Name: NF14315_low_53
Description: NF14315
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14315_low_53 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 111; Significance: 3e-56; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 111; E-Value: 3e-56
Query Start/End: Original strand, 62 - 184
Target Start/End: Original strand, 8438811 - 8438933
Alignment:
| Q |
62 |
gatgagagatagagttagtttaaaaaaggatagagagaaagtcatcaagaatagacaatcctaacctaatttaaatatagtttaagtgagatatgaatgt |
161 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8438811 |
gatgagagatagagttagtttaaagaaggatagagagaaagtcatcaaaaatagacaatcctaacctaatttaaatatagtttaagtgagatatgaatgt |
8438910 |
T |
|
| Q |
162 |
gatgatcggacataggggcaaac |
184 |
Q |
| |
|
||||||| ||||||||||||||| |
|
|
| T |
8438911 |
gatgatcagacataggggcaaac |
8438933 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University