View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14317_high_13 (Length: 317)
Name: NF14317_high_13
Description: NF14317
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14317_high_13 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 272; Significance: 1e-152; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 272; E-Value: 1e-152
Query Start/End: Original strand, 15 - 294
Target Start/End: Complemental strand, 19418473 - 19418194
Alignment:
| Q |
15 |
cataggcaagaatttgattattagatcagaagactagataccaaagttttaaattcaagtgtcaattatcgatgttgcgagaaattaaatgtggttgatg |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19418473 |
cataggcaagaatttgattattagatcagaagactagataccaaagttttaaattcaagtgtcaattatcgatgttgcgagaaattaaatgtggttgatg |
19418374 |
T |
 |
| Q |
115 |
cagtctggactagggtctcagacctttgtggaaaaatcgtgtcggatggcatggttttgaattgcagtttgcgatcggatttgtagtagccaaccgacat |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||| |
|
|
| T |
19418373 |
cagtctggactagggtctcagacctttgtggaaaaatcgtgtcggatggcatggttttgaattgcagtttgcgatcggagttgtagtaaccaaccgacat |
19418274 |
T |
 |
| Q |
215 |
tgcaactacaatttcgattgcattggccatgttttttcgcaattataaataagattcacaacaaaattgcaacgatttct |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19418273 |
tgcaactacaatttcgattgcattggccatgttttttcgcaattataaataagattcacaacaaaattgcaacgatttct |
19418194 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University