View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14317_high_16 (Length: 281)
Name: NF14317_high_16
Description: NF14317
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14317_high_16 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 235; Significance: 1e-130; HSPs: 5)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 1 - 263
Target Start/End: Original strand, 30691090 - 30691352
Alignment:
| Q |
1 |
acttaaccgttgaatctatgtctaacatttccttttccttttgaattaaccgccacctcatattgcttctagatgtaggattagatatactaatcaccat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
30691090 |
acttaaccgttgaatctatgtctaacatttcctttttcttttgaattaaccgccacctcatattgcttctggatgtaggattagatatactaatcaccac |
30691189 |
T |
|
| Q |
101 |
cgtcttcaagttcacacaaaactcaaagaccaactctatttgccttagcaaagctggaaattcgattgccatcactttacatatttttatggagtaacaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||| |
|
|
| T |
30691190 |
cgtcttcaagttcacacaaaactcaaagaccaactctaattgccttagcaaagctggaaattcgattgccatcactttacatgttttcatggagtaacaa |
30691289 |
T |
|
| Q |
201 |
taaataataatgggaaaacaaaataattctcactcgtggttgggggatcatatataaggattg |
263 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
30691290 |
taaataataatgggaaaacaaaataattctcactcgtggttggggtatcatatataaggattg |
30691352 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 3 - 128
Target Start/End: Original strand, 30690157 - 30690282
Alignment:
| Q |
3 |
ttaaccgttgaatctatgtctaacatttccttttccttttgaattaaccgccacctcatattgcttctagatgtaggattagatatactaatcaccatcg |
102 |
Q |
| |
|
|||||||||||| || |||||||||||||||| |||||||||||||| |||||||||| | ||||||||||||||||||||| |||| ||| || || |
|
|
| T |
30690157 |
ttaaccgttgaaacttcttctaacatttcctttttcttttgaattaaccatcacctcatatagtttctagatgtaggattagatagactattcatcaccg |
30690256 |
T |
|
| Q |
103 |
tcttcaagttcacacaaaactcaaag |
128 |
Q |
| |
|
||||||||| |||||||||||||||| |
|
|
| T |
30690257 |
tcttcaagtccacacaaaactcaaag |
30690282 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 21 - 74
Target Start/End: Original strand, 30690852 - 30690905
Alignment:
| Q |
21 |
tctaacatttccttttccttttgaattaaccgccacctcatattgcttctagat |
74 |
Q |
| |
|
|||| ||||||||||| ||||||||||||| ||||||||||||||||||||| |
|
|
| T |
30690852 |
tctatcatttcctttttcttttgaattaactatcacctcatattgcttctagat |
30690905 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 1 - 74
Target Start/End: Original strand, 30717548 - 30717621
Alignment:
| Q |
1 |
acttaaccgttgaatctatgtctaacatttccttttccttttgaattaaccgccacctcatattgcttctagat |
74 |
Q |
| |
|
|||||||||||||||| || || ||||||||||||| |||||||||||| || | ||| |||||||| ||||| |
|
|
| T |
30717548 |
acttaaccgttgaatccatatccaacatttcctttttcttttgaattaatcgtcttctcttattgcttttagat |
30717621 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 18 - 74
Target Start/End: Original strand, 30690651 - 30690707
Alignment:
| Q |
18 |
atgtctaacatttccttttccttttgaattaaccgccacctcatattgcttctagat |
74 |
Q |
| |
|
||||||||||||||||||| |||||||||| | || |||| |||||||||| ||||| |
|
|
| T |
30690651 |
atgtctaacatttcctttttcttttgaattcatcgtcaccacatattgcttttagat |
30690707 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University