View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14317_high_24 (Length: 236)

Name: NF14317_high_24
Description: NF14317
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14317_high_24
NF14317_high_24
[»] chr5 (2 HSPs)
chr5 (154-229)||(19418784-19418859)
chr5 (1-59)||(19418630-19418689)


Alignment Details
Target: chr5 (Bit Score: 72; Significance: 7e-33; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 154 - 229
Target Start/End: Original strand, 19418784 - 19418859
Alignment:
154 cagagaagtgagaatgttcagcaggattatacgcacgatcatgaatacgatgatcacggtgacggtgatgatgatg 229  Q
    ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
19418784 cagagaagtgagaatgttctgcaggattatacgcacgatcatgaatacgatgatcacggtgacggtgatgatgatg 19418859  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 1 - 59
Target Start/End: Original strand, 19418630 - 19418689
Alignment:
1 ttaacagcagaaaattctt-ttctttcctaatcaatatatcatatcatcctgcttgcata 59  Q
    ||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||    
19418630 ttaacagcagaaaattcttattctttcctaatcaatacatcatatcatcctgcttgcata 19418689  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University