View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14317_high_26 (Length: 216)
Name: NF14317_high_26
Description: NF14317
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14317_high_26 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 141; Significance: 4e-74; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 141; E-Value: 4e-74
Query Start/End: Original strand, 18 - 188
Target Start/End: Complemental strand, 7153024 - 7152855
Alignment:
| Q |
18 |
tggtcaacacatcagtcattcaatttcattaatgatgtcaattatggagctttactctcttgcttgagtcagaataaactatcatttcttatctaagagt |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
7153024 |
tggtcaacacatcagtcattcaatttcattaatgatgtcaattatggagctttactctcttgcttgagtcagaataaactatcctttcttatctaagagt |
7152925 |
T |
 |
| Q |
118 |
cg-tgtgtacatgcatgatgattctttgagtcaattgcttactatatattgatctcacttcaaaagcttgta |
188 |
Q |
| |
|
|| || |||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||| |
|
|
| T |
7152924 |
cgttgcgtacatgcatgatgattctttgagtcaattgcttac--tatattgatctcacttcaaaggcttgta |
7152855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University