View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14317_high_6 (Length: 391)
Name: NF14317_high_6
Description: NF14317
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14317_high_6 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 280; Significance: 1e-157; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 280; E-Value: 1e-157
Query Start/End: Original strand, 66 - 388
Target Start/End: Complemental strand, 45208441 - 45208118
Alignment:
| Q |
66 |
cggtattagacatgacacatgtcgaatatcgggacatagtttcaattaaaagttttggtgcaacgggaactattttgatcgaatattttggttgcaataa |
165 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
45208441 |
cggtattagacatgacacatatcgaatatcgggacatagtttcaattaaaagttttggtgcaacgtgaactattttgatcgaatattttggttgcaataa |
45208342 |
T |
|
| Q |
166 |
gaaaaatatatcatcaagaaacccattaatattcagatccggattctttattgt-aagaaacacgcagtttaacgttgtagtcaatctccgtcattgatt |
264 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
45208341 |
gaaaaatatatcatcaagaaacccattaatattcagatccggattctttattgtaaaaaaacacgcagtttaatgttgtagtcaatctccgtcattgatt |
45208242 |
T |
|
| Q |
265 |
ttaaaatcaattttacacaatcgaataacctcaatcgtgactggagatcccaacaagtcgatatcttccactttggcacaccaattcctcttattatggt |
364 |
Q |
| |
|
|||||||||||||| ||||||||||||| |||| ||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||| |
|
|
| T |
45208241 |
ttaaaatcaattttgcacaatcgaataatctcagtcgtgactggagatcccaacaagtcgatatcttccgctttgccacaccaattcctcttattatggt |
45208142 |
T |
|
| Q |
365 |
atatagaataaatggttaaatatt |
388 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
45208141 |
atatagaataaatggttaaatatt |
45208118 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University