View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14317_low_17 (Length: 294)

Name: NF14317_low_17
Description: NF14317
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14317_low_17
NF14317_low_17
[»] chr2 (1 HSPs)
chr2 (20-251)||(4097922-4098152)


Alignment Details
Target: chr2 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 20 - 251
Target Start/End: Original strand, 4097922 - 4098152
Alignment:
20 tttgtatgccttttgtaacatgcaactgaaaatcatgttctgggattgtgatgtgtgctatgaacatgtttcttttaacannnnnnnagccttcaatatt 119  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||       |||||||||||||    
4097922 tttgtatgccttttgtaacatgcaactgaaaatcatgttctgggattgtgatgtgtgctatgaacatgttt-ttttaacatttttttagccttcaatatt 4098020  T
120 ttattggataaaattaaccgtatctttcatatttttaaaatgaatttcatataaaatagtgagatcaacataaattgcattcaataaaatgttaaaagtt 219  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||    
4098021 ttattggataaaattaaccgtatctttcatatttttaaaatgaatttcatataaaatagtgagatcaacataaattgcattcaataaaatgataaatgtt 4098120  T
220 aaaaacagagtgttttgattactactattact 251  Q
    ||||||||||||||||| ||||||||||||||    
4098121 aaaaacagagtgttttggttactactattact 4098152  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University