View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14317_low_17 (Length: 294)
Name: NF14317_low_17
Description: NF14317
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14317_low_17 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 20 - 251
Target Start/End: Original strand, 4097922 - 4098152
Alignment:
| Q |
20 |
tttgtatgccttttgtaacatgcaactgaaaatcatgttctgggattgtgatgtgtgctatgaacatgtttcttttaacannnnnnnagccttcaatatt |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||| |
|
|
| T |
4097922 |
tttgtatgccttttgtaacatgcaactgaaaatcatgttctgggattgtgatgtgtgctatgaacatgttt-ttttaacatttttttagccttcaatatt |
4098020 |
T |
|
| Q |
120 |
ttattggataaaattaaccgtatctttcatatttttaaaatgaatttcatataaaatagtgagatcaacataaattgcattcaataaaatgttaaaagtt |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||| |
|
|
| T |
4098021 |
ttattggataaaattaaccgtatctttcatatttttaaaatgaatttcatataaaatagtgagatcaacataaattgcattcaataaaatgataaatgtt |
4098120 |
T |
|
| Q |
220 |
aaaaacagagtgttttgattactactattact |
251 |
Q |
| |
|
||||||||||||||||| |||||||||||||| |
|
|
| T |
4098121 |
aaaaacagagtgttttggttactactattact |
4098152 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University