View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14317_low_21 (Length: 274)
Name: NF14317_low_21
Description: NF14317
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14317_low_21 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 145; Significance: 2e-76; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 13 - 170
Target Start/End: Complemental strand, 9010838 - 9010679
Alignment:
| Q |
13 |
actttcctaattatgttaatatattcttgtcattatcttggcatcttcatatgagaca--aaaatatgttgatacatatgggacactattaaaattttca |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
9010838 |
actttcctaattatgttaatatattcttgtcattatcttggcatcttcatatgagacataaaaatatgttgatagatatgggacactattaaaattttca |
9010739 |
T |
|
| Q |
111 |
attatcaacataacacaaatgatagatgttttggtatttgaactatgtagttggagattt |
170 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9010738 |
attatcaacataacacaaatgatagatgttttggtatttgaactatgtagttggagattt |
9010679 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 201 - 259
Target Start/End: Complemental strand, 9010593 - 9010531
Alignment:
| Q |
201 |
ttttaattgatgactatttgcaatgaagatacacaactg----aatgcaaatgtgtggattct |
259 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||| |
|
|
| T |
9010593 |
ttttaattgatgactatttgcaatggagatacacaactgaatgaatgcaaatgtgtggattct |
9010531 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University