View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14317_low_23 (Length: 247)
Name: NF14317_low_23
Description: NF14317
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14317_low_23 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 1 - 237
Target Start/End: Original strand, 812770 - 813005
Alignment:
| Q |
1 |
tatttattacaaaatcaaaatagttctttgactgcgcaagagggagaagattgaagaaggtaatggaaatcaaattcattttacttacaacatgacatga |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
812770 |
tatttattacaaaatcaaaatagttctttgactgcgcaagagggagaagat-gaagaaggtaatggaaatcaaattcattttacttacaacatgacatga |
812868 |
T |
 |
| Q |
101 |
aaaacacaaaaatgaaattgtaagtttgaaacccacaaatcattcatnnnnnnntcaaataaattgagatttgacaagatcaaaacacaacccaattaaa |
200 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||| || |||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
812869 |
aaaacacaaaaatcaaattgtaagtttgaaacccacaaatcattgataaaaaaatcaaataaattgagatttgacaagatgaaaacacaacccaattaaa |
812968 |
T |
 |
| Q |
201 |
catgttgaagatatgaaaaagaaatgaagttaaccct |
237 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
812969 |
catgttgaagatatgaaaaagaaatgaagctaaccct |
813005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University