View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14317_low_25 (Length: 242)
Name: NF14317_low_25
Description: NF14317
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14317_low_25 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 144; Significance: 8e-76; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 144; E-Value: 8e-76
Query Start/End: Original strand, 77 - 224
Target Start/End: Original strand, 48667209 - 48667356
Alignment:
| Q |
77 |
atcatgacgatggtgaatttgctgaatgcgttgacagtgagtcggatattgactcgtgaccacttatctctcgccaatgaaggcataccttttggatccg |
176 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48667209 |
atcatgacgatggtgaatttgctgaatgcgttgacagtgagtcggatattgactcgtgatcacttatctctcgccaatgaaggcataccttttggatccg |
48667308 |
T |
 |
| Q |
177 |
taacatggatcgcttatgtcggcatctgttgttttctcgtatgctttg |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48667309 |
taacatggatcgcttatgtcggcatctgttgttttctcgtatgctttg |
48667356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 80 - 192
Target Start/End: Original strand, 2792470 - 2792582
Alignment:
| Q |
80 |
atgacgatggtgaatttgctgaatgcgttgacagtgagtcggatattgactcgtgaccacttatctctcgccaatgaaggcataccttttggatccgtaa |
179 |
Q |
| |
|
||||||||| |||| ||| | ||||||||| | ||||||||||||||||||||||| | | ||||||| | ||| ||||||||||||| || | || |
|
|
| T |
2792470 |
atgacgatgatgaacttgataaatgcgttggcggtgagtcggatattgactcgtgatccatccgttctcgcccacgaaagcataccttttgggtcggcaa |
2792569 |
T |
 |
| Q |
180 |
catggatcgctta |
192 |
Q |
| |
|
||||||||||||| |
|
|
| T |
2792570 |
catggatcgctta |
2792582 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 144 - 213
Target Start/End: Original strand, 16387793 - 16387862
Alignment:
| Q |
144 |
ctctcgccaatgaaggcataccttttggatccgtaacatggatcgcttatgtcggcatctgttgttttct |
213 |
Q |
| |
|
|||||||||| ||||||||||||||||| || | ||||||||| ||||| | ||| || || |||||||| |
|
|
| T |
16387793 |
ctctcgccaacgaaggcataccttttggttctgcaacatggattgcttacgccggaatatgctgttttct |
16387862 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University