View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14317_low_26 (Length: 241)
Name: NF14317_low_26
Description: NF14317
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14317_low_26 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 192; Significance: 1e-104; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 1 - 224
Target Start/End: Complemental strand, 812744 - 812514
Alignment:
| Q |
1 |
tattttatatttttataattattttgggctaaagaggaaaactacggtgttttcacggtggcgctgtggcagtgattgttgtgttaaataaagttttgaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
812744 |
tattttatatttttataattattttgggctaaagaggaaaactacggtgttttcacggtggcgctgtggcagtgattgttgtgttaaataaatttttgaa |
812645 |
T |
|
| Q |
101 |
gaat-ccaatatgcttcgatatgtaacacaaaaaagaaaataatataccttttgtagacatacaaattacatta------caatttgttgttgctaatgg |
193 |
Q |
| |
|
|||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
812644 |
gaatcccaatatgcttcgatatgtaacacataaaagaaaataatataccttttgtagacatacaaattacattacaatttcaatttgttgttgctaatgg |
812545 |
T |
|
| Q |
194 |
taaaaacaatatcagaaactcatgcatgtat |
224 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
812544 |
taaaaacaatatcagaaactcatgcatgtat |
812514 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 32 - 92
Target Start/End: Complemental strand, 811893 - 811833
Alignment:
| Q |
32 |
aagaggaaaactacggtgttttcacggtggcgctgtggcagtgattgttgtgttaaataaa |
92 |
Q |
| |
|
||||||||||| | ||||| | |||||||||| |||||||||||||||||||| ||||||| |
|
|
| T |
811893 |
aagaggaaaacgatggtgtatgcacggtggcgttgtggcagtgattgttgtgtgaaataaa |
811833 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University