View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14317_low_27 (Length: 236)
Name: NF14317_low_27
Description: NF14317
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14317_low_27 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 72; Significance: 7e-33; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 154 - 229
Target Start/End: Original strand, 19418784 - 19418859
Alignment:
| Q |
154 |
cagagaagtgagaatgttcagcaggattatacgcacgatcatgaatacgatgatcacggtgacggtgatgatgatg |
229 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19418784 |
cagagaagtgagaatgttctgcaggattatacgcacgatcatgaatacgatgatcacggtgacggtgatgatgatg |
19418859 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 1 - 59
Target Start/End: Original strand, 19418630 - 19418689
Alignment:
| Q |
1 |
ttaacagcagaaaattctt-ttctttcctaatcaatatatcatatcatcctgcttgcata |
59 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
19418630 |
ttaacagcagaaaattcttattctttcctaatcaatacatcatatcatcctgcttgcata |
19418689 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University