View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14317_low_31 (Length: 207)
Name: NF14317_low_31
Description: NF14317
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14317_low_31 |
 | |
|
| [»] scaffold1064 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold1064 (Bit Score: 92; Significance: 7e-45; HSPs: 1)
Name: scaffold1064
Description:
Target: scaffold1064; HSP #1
Raw Score: 92; E-Value: 7e-45
Query Start/End: Original strand, 4 - 103
Target Start/End: Original strand, 2605 - 2704
Alignment:
| Q |
4 |
atcttgtcaggaatcttatcctaactaatcaaaactctagtttctttatagtatgcagcaatatactctgcaattactacatgatggttttccattgaga |
103 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2605 |
atcttgtcaggaatctgatcctaactaatcaaaactctagtttctttgtagtatgcagcaatatactctgcaattactacatgatggttttccattgaga |
2704 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 52 - 84
Target Start/End: Original strand, 26825353 - 26825385
Alignment:
| Q |
52 |
tagtatgcagcaatatactctgcaattactaca |
84 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| |
|
|
| T |
26825353 |
tagtatgcagcaatgtactctgcaattactaca |
26825385 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University