View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14318_low_13 (Length: 311)
Name: NF14318_low_13
Description: NF14318
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14318_low_13 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 255; Significance: 1e-142; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 255; E-Value: 1e-142
Query Start/End: Original strand, 1 - 300
Target Start/End: Original strand, 49040106 - 49040401
Alignment:
| Q |
1 |
tcagtgttggatgctatgcagtattatctagaactaagtgagtggcatatggagccatctcgttccacattacaccgctttggtaacacttcaagtagtt |
100 |
Q |
| |
|
||||||||||||||||||||| || || |||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
49040106 |
tcagtgttggatgctatgcagaataatatagaactaagtgagtggcatatggagccatcttgttccacattacatcgctttggtaacacttcaagtagtt |
49040205 |
T |
 |
| Q |
101 |
cactttggtatgagttagcatacgtagaggccaagggtagagtttcaaagggggatagggtgtggcagattgattgcatttggggctggttttaaatgta |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||| |
|
|
| T |
49040206 |
cactttggtatgagttagcatacgtagaggccaagggtagagtttcaaagggggatagggtgtggca----gattgcatttggggcaggttttaaatgta |
49040301 |
T |
 |
| Q |
201 |
acagtgccgtatggagggcatgtcgtgacataccacttctacatgactggacgggaaatccatgggatgactctgttaacaactaccctattcatctctc |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
49040302 |
acagtgccgtatggagggcatgtcgtgacataccacttctacatgactggacgggaaatccatgggatgactctgttaacaactaccctattcatttctc |
49040401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.0000001; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 81 - 122
Target Start/End: Complemental strand, 19671813 - 19671772
Alignment:
| Q |
81 |
tggtaacacttcaagtagttcactttggtatgagttagcata |
122 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||| ||||| |
|
|
| T |
19671813 |
tggtaacacttcaagtagttctgtttggtatgagttggcata |
19671772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 81 - 122
Target Start/End: Complemental strand, 19742933 - 19742892
Alignment:
| Q |
81 |
tggtaacacttcaagtagttcactttggtatgagttagcata |
122 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||| ||||| |
|
|
| T |
19742933 |
tggtaacacttcaagtagttctgtttggtatgagttggcata |
19742892 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 81 - 122
Target Start/End: Original strand, 19797155 - 19797196
Alignment:
| Q |
81 |
tggtaacacttcaagtagttcactttggtatgagttagcata |
122 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||| ||||| |
|
|
| T |
19797155 |
tggtaacacttcaagtagttctgtttggtatgagttggcata |
19797196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University