View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14318_low_16 (Length: 296)
Name: NF14318_low_16
Description: NF14318
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14318_low_16 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 130; Significance: 2e-67; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 136 - 293
Target Start/End: Original strand, 28715499 - 28715656
Alignment:
| Q |
136 |
gtggatcgtttgtatagagattcatctctttgctttcataaaatattgcactaagttttacacaaactttctatgcgtaactcaatcatcttccctttca |
235 |
Q |
| |
|
||||||| ||||||||||||||||||||||| ||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28715499 |
gtggatcatttgtatagagattcatctctttcctttcattaaatattctactaagttttacacaaactttctatgcgtaactcaatcatcttccctttca |
28715598 |
T |
|
| Q |
236 |
tctgggtttatgacagactatgtgtatggtaaagtaaaacataggcttattcaatcac |
293 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||| |
|
|
| T |
28715599 |
tctgggtttatgacagactatgtgtatggtaaagtaaaatataggtttattcaatcac |
28715656 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 17 - 107
Target Start/End: Original strand, 28715378 - 28715470
Alignment:
| Q |
17 |
tatacgagaggattagctatttcctcagtaataaaatattttgtt--gagactatgaattttgaagttttgaaccgcaatcgacttgtgagta |
107 |
Q |
| |
|
|||||||||||||| |||||||||| ||||||||||||||||||| |||||||| |||||| |||||||||||||||||||||||||||||| |
|
|
| T |
28715378 |
tatacgagaggatttgctatttccttagtaataaaatattttgttgagagactattaattttaaagttttgaaccgcaatcgacttgtgagta |
28715470 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University